Q 1 :

Which one is the correct product of DNA dependent RNA polymerase to the given template?                    [2024]
3′ TACATGGCAAATATCCATTCA 5′

  • 5′ AUGUACCGUUUAUAGGUAAGU 3′

     

  • 5′ AUGUAAAGUUUAUAGGUAAGU 3′

     

  • 5′ AUGUACCGUUUAUAGGGAAGU 3′

     

  • 5′ ATGTACCGTTTATAGGTAAGT 3′

     

(1)

 



Q 2 :

Match List I with List II.                                   [2024]

  List I   List II
A. RNA polymerase III (I) snRNPs
B. Termination of transcription (II) Promotor
C. Splicing of exons (III) Rho factor
D. TATA box (IV) SnRNAs, tRNA

 

Choose the correct answer from the options given below:

  • A-II, B-IV, C-I, D-III

     

  • A-III, B-II, C-IV, D-I

     

  • A-III, B-IV, C-I, D-II

     

  • A-IV, B-III, C-I, D-II

     

(4)

 



Q 3 :

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and downstream end.          [2024]

  • repressor, operator gene, structural gene

     

  • structural gene, transposons, operator gene

     

  • inducer, repressor, structural gene

     

  • promotor, structural gene, terminator

     

(4)

In transcription unit, the promoter and terminator flank the structural gene. The promoter is said to be located towards 5′-end (upstream) of the structural gene and the terminator towards the 3′-end (downstream) of the coding strand.

 



Q 4 :

Given below are two statements:                                                                                                                        [2023]

Statement I: The process of copying genetic information from one strand of the DNA into RNA is termed as transcription.
Statement II: A transcription unit in DNA is defined primarily by the three regions in the DNA i.e., a promotor, the structural gene and a terminator.

In the light of the above statements, choose the correct answer from the options given below:

  • Statement I is true but statement II is false.

     

  • Statement I is false but statement II is true.

     

  • Both statement I and statement II are true.

     

  • Both statement I and statement II are false.

     

(3)

 



Q 5 :

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?            [2023]

  • Transcription of precursor of mRNA

     

  • Transcription of only snRNAs

     

  • Transcription of rRNAs (28S, 18S and 5.8S)

     

  • Transcription of tRNA, 5 SrRNA and snRNA

     

(4)

RNA polymerase III is responsible for transcription of tRNA, 5SrRNA and snRNAs (small nuclear RNAs). RNA polymerase I transcribes rRNA (28S, 18S and 5.8S) whereas RNA polymerase II transcribes precursor of mRNA, the heterogeneous nuclear RNA (hnRNA).

 



Q 6 :

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows:             [2023]

5′ AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3′

  • 5′ ATCGATCGATCGATCGATCGATCGATCG 3′

     

  • 3′ ATCGATCGATCGATCGATCGATCGATCG 5′

     

  • 5′ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3′

     

  • 3′ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5′

     

(1)

 



Q 7 :

What is the role of RNA polymerase III in the process of transcription in eukaryotes?             [2021]

  • Transcribes only snRNAs

     

  • Transcribes rRNAs (28S, 18S and 5.8S)

     

  • Transcribes tRNA, 5S rRNA and snRNA

     

  • Transcribes precursor of mRNA

     

(3)

 



Q 8 :

Identify the correct statement.                                             [2021]

  • Split gene arrangement is characteristic of prokaryotes.

     

  • In capping, methyl guanosine triphosphate is added to the 3′ end of hnRNA.

     

  • RNA polymerase binds with Rho factor to terminate the process of transcription in bacteria.

     

  • The coding strand in a transcription unit is copied to an mRNA.

     

(3)

Split gene arrangement is a characteristic of eukaryotes. In capping, an unusual nucleotide (methyl guanosine triphosphate) is added to the 5′-end of hnRNA. RNA polymerase binds with termination factor Rho (ρ) to terminate the process of transcription in bacteria. The coding strand does not code for anything.

 



Q 9 :

Which is the “only enzyme” that has “capability” to catalyse initiation, elongation and termination in the process of transcription in prokaryotes?         [2021]

  • DNase

     

  • DNA dependent DNA polymerase

     

  • DNA dependent RNA polymerase

     

  • DNA Ligase

     

(3)

In bacteria, there is a single DNA dependent RNA polymerase that catalyses transcription of all types of RNA. It associates transiently with initiation factor (σ) and termination factor (ρ) to carry out initiation and termination of transcription respectively. It catalyses the elongation as its uses nucleoside triphosphates as substrates and polymerises in a template dependent fashion as rule of complementarity.

 



Q 10 :

Name the enzyme that facilitates opening of DNA helix during transcription.               [2020]

  • DNA ligase

     

  • DNA helicase

     

  • DNA polymerase

     

  • RNA polymerase

     

(4)

 



Q 11 :

What will be the sequence of mRNA produced by the following stretch of DNA?                [2019]

3′ ATGCATGCATGCATG 5′ TEMPLATE STRAND
5′ TACGTACGTACGTAC 3′ CODING STRAND

  • 3′ AUGCAUGCAUGCAUG 5′

     

  • 5′ UACGUACGUACGUAC 3′

     

  • 3′ UACGUACGUACGUAC 5′

     

  • 5′ AUGCAUGCAUGCAUG 3′

     

(2)

 



Q 12 :

Match the following RNA polymerase with their transcribed products:                    [2019]

1. RNA polymerase I — (i) tRNA

2. RNA polymerase II — (ii) rRNA

3. RNA polymerase III — (iii) hnRNA

Select the correct option from the following:

  • 1 - i, 2 - iii, 3 - ii

     

  • 1 - i, 2 - ii, 3 - iii

     

  • 1 - ii, 2 - iii, 3 - i

     

  • 1 - iii, 2 - ii, 3 - i

     

(3)

 



Q 13 :

Select the correct statement.                     [2018]

  • Franklin Stahl coined the term “linkage”.

     

  • Punnett square was developed by a British scientist.

     

  • Spliceosomes take part in translation.

     

  • Transduction was discovered by S. Altman.

     

(2)

Franklin Stahl along with Matthew Meselson proved semi-conservative mode of replication in DNA. Punnett square was developed by a British geneticist, Reginald C. Punnett. Spliceosome formation is part of post-transcriptional change in eukaryotes. Transduction was discovered by Joshua Lederberg and Norton Zinder in the bacterium Salmonella.

 



Q 14 :

AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA?         [2018]

  • AGGUAUCGCAU

     

  • UGGTUTCGCAT

     

  • ACCUAUGCGAU

     

  • UCCAUAGCGUA

     

(1)

Coding strand and mRNA have same nucleotide sequence except, ‘T’ – Thymine is replaced by ‘U’ – Uracil in mRNA.

 



Q 15 :

Which of the following RNAs should be most abundant in animal cell?                [2017]

  • tRNA

     

  • mRNA

     

  • miRNA

     

  • rRNA

     

(4)

rRNA (ribosomal RNA) is the most abundant of all types of RNA (70–88%). Hence, it will be present in highest amount. Percentage of tRNA and mRNA is 15% and 2–5% respectively. miRNA (micro RNA) are 21–22 bp long RNA that bring degeneration of mRNA.

 



Q 16 :

Spliceosomes are not found in cells of                      [2017]

  • fungi

     

  • animals

     

  • bacteria

     

  • plants

     

(3)

Spliceosomes help in removal of introns. They will not occur in prokaryotes because prokaryotes do not have introns and thus, processing does not require splicing of mRNA.

 



Q 17 :

The equivalent of a structural gene is                  [2016]

  • muton

     

  • cistron

     

  • operon

     

  • recon

     

(2)

Cistron (or gene) is a length of DNA that contains the information for coding a specific polypeptide chain or a functional RNA molecule (i.e., transfer RNA or ribosomal RNA). Hence, cistron is a unit of function. Currently such a gene is called structural gene.

 



Q 18 :

Which of the following rRNAs acts as structural RNA as well as ribozyme in bacteria?                [2016]

  • 5S rRNA

     

  • 18S rRNA

     

  • 23S rRNA

     

  • 5.8S rRNA

     

(3)

23S rRNA acts as structural RNA as well as ribozyme in bacteria.

 



Q 19 :

DNA-dependent RNA polymerase catalyses transcription on one strand of the DNA which is called the           [2016]

  • template strand

     

  • coding strand

     

  • alpha strand

     

  • antistrand

     

(1)

The strand of DNA on which RNA polymerase binds to catalyse transcription is called template strand. It is also known as master or antisense strand. It has the polarity of 3′ → 5′.

 



Q 20 :

Select the correct option.                           [2014]

 

  • Direction of RNA synthesis - 5′ – 3′

    Direction of reading of the template DNA strand - 3′ – 5′

     

  • Direction of RNA synthesis - 3′ – 5′

    Direction of reading of the template DNA strand - 5′ – 3′

     

  • Direction of RNA synthesis - 5′ – 3′

    Direction of reading of the template DNA strand - 5′ – 3′

     

  • Direction of RNA synthesis - 3′ – 5′

    Direction of reading of the template DNA strand - 3′ – 5′

     

(1)

RNA polymerase initiates and extends the RNA (chain elongation) and functions always in 5′ to 3′ direction. The structural component of DNA has 3′ to 5′ polarity. It is also called template DNA strand or antisense (–) strand.

 



Q 21 :

Which of the following are the post-transcriptional events in an eukaryotic cell?                   [2025]

A. Transport of pre-mRNA to cytoplasm prior to splicing.

B. Removal of introns and joining of exons.

C. Addition of methyl group at 5’ end of hnRNA.

D. Addition of adenine residues at 3' end of hnRNA.

E. Base pairing of two complementary RNAs.

Choose the correct answer from the options given below :

  • A, B, C only

     

  • B, C, D only

     

  • B, C, E only

     

  • C, D, E only

     

(2)

The process of copying genetic information from one strand of the DNA into RNA is known as transcription. It occurs in the cytoplasm with the help of transcripting enzyme.

Transport of pre-mRNA to cytoplasm prior to splicing is a part of transcription.

The primary transcript is converted into functional mRNA after post transcriptional processing involves 3 steps as follows-

•   Modification of 5’ end by capping,

•   Tailing,

•   Splicing.

Base pairing of two complementary RNA is not on event of post-transcription. Hence, statements B, C, D are post-transcriptional modification events in eukaryotic cell.

 



Q 22 :

Which factor is important for termination of transcription?                     [2025]

  • α (alpha)

     

  • σ (sigma)

     

  • ρ (rho)

     

  • γ (gamma)

     

(3)

In prokaryotes the RNA polymerase is only capable of catalysing the process of elongation. It associates transiently with initiation factor (σ) and termination factor (ρ) to initiate and terminate the transcription respectively.